Skip to main content
Download PDF
Download ePub
  • Research Article
  • Open access
  • Published:

Association of Epstein - Barr virus and breast cancer in Eritrea

Infectious Agents and Cancer volume 12, Article number: 62 (2017) Cite this article

Abstract

Background

The oncogenic potential of Epstein-Barr virus (EBV) in breast cancer is being increasingly recognized. Despite some controversies regarding such role, new evidence is suggesting a culpability of EBV in breast cancer, particularly in Africa where the virus has been originally associated with causation of several solid and hematological malignancies. One example is a report from Sudan implicating EBV as a prime etiologic agent for an aggressive type of breast cancer, where nearly 100% of tumor tissues were shown to carry viral signatures. To get a broader view on such association, other nearby countries should be investigated. The present study aims to determine the prevalence and possible associations of the virus in Eritrean breast cancer patients.

Methods

Detection of EBV genome using primers that target Epstein Barr Encoded RNA (EBER) gene and Latent Membrane Protein-1 (LMP-1) gene sequences was performed by polymerase chain reaction (PCR) on DNA samples extracted from 144 formalin fixed paraffin embedded breast cancer tissues and 63 non-cancerous breast tissue as control group. A subset of PCR positive samples was evaluated for EBER gene expression by in situ hybridization (ISH). Expression of Latent Membrane Protein-2a (LMP2a) was also assessed by immunohistochemistry in a subset of 45 samples.

Results

Based on PCR results, EBV genome signals were detected in a total of 40 samples (27.77%) as compared to controls (p-value = 0. 0031) with a higher sensitivity when using the EBER primers. Five out of the 14 samples stained by EBER-ISH 35.71% were positive for the virus indicating the presence of the viral genome within the tumor cells. Of those stained for IHC 7 (15.55%) were positive for LMP2a showing low viral protein frequency.

Conclusions

Based on these findings it can be concluded that EBV in Eritrea is associated with a smaller subset of tumors, unlike neighboring Sudan, thus pointing to possible differences in population predisposition and diseases epidemiology.

Background

Breast cancer is the most common form of malignancy in women both in developed and the developing countries [1]. In Sub Saharan Africa, although the prevalence is relatively lower compared to that of the western countries, it is characterized by aggressive course and targets more women at a younger age [2]. Breast cancer etiology is not yet entirely known, but its incidence is partially explained by environmental factors including viruses such as Epstein-Barr virus [3]. EBV is closely associated with endemic Burkitt lymphoma in sub-Saharan Africa [4] and more recently reported to be a culprit of breast cancer in Sudan [5]. It is a cosmopolitan γ-herpes virus which infects usually at younger age [6]. Its main target are B lymphocytes but it has a potential to infect epithelial cells as well [7] and is associated with a number of lymphoid and epithelial [8] cancers and thus it is classified as a carcinogenic agent by the International Agency for Research in Cancer [9].

There is conflicting evidence as to the role of EBV in breast cancer [5, 10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25]. The differences are believed to be due to the usage of different techniques, various types of tissue samples, geographical and genetic variation of viral and host genomes, racial and socioeconomic variation of study populations [26,27,28]. Some authors believe that EBV may play a role in breast cancer oncogenesis not as a primary etiological agent but acts in concert with other co-factors [29]. A meta-analysis study concluded that EBV acts as a cofactor in breast cancer development [30].

In Sudan, where aggressive breast cancer is prevailing, EBV is believed to be associated with this cancer based on viral detection in cancer tissues [5] and on molecular evidence from methylome analysis and expression data published online (bioRxivDoi: 10.1101/03432).

The current study was initiated with the aim of finding out whether EBV is a common etiology of breast cancer in East Africa or whether different countries and populations may present with different pattern.

Methods

Patients and tissues

This study comprises formalin fixed paraffin- embedded (FFPE) cancer biopsies from 144 cases of breast carcinoma retrieved from the Department of Histopathology, National Health Laboratory, Ministry of Health, Eritrea during 2013, 2014. The Department is the only of its kind and receives sample from all hospitals within the country. Noncancerous tissue samples from the same directory (n=63) were used as a controls. Clinical data including age, tumor type, size and involved lymph node were also collected. Eight 10μ thick sections were cut by a sterile microtome blade from each tumor paraffin blocks for subsequent DNA extraction and then amplification. From a subset (n=59) of the study blocks additional 4μm thick sections were cut and put onto positive charged slides (Dako) for the use of immunohistochemistry (IHC) as well as in situ hybridization (ISH) assays.

DNA extraction from FFPE

DNA was extracted from FFPE breast cancer tissues (n=144) and non-cancerous tissues (n= 63) using guanidine chloride for buccal wash method (Black-well laboratory Cambridge, UK) modified to suite for FFPE samples as follows: without dewaxing samples were subject to lyses solution containing 400mMNaCl, 6M guanidine chloride and 300 μl of 7.5% ammonium acetate without proteinase K and heat treated at 98°C for 20 minutes in water bath to reverse formaldehyde modification of the FFPE samples. After cooling10μl (20 mg/ml stock) proteinase K was added and incubated for overnight at 56°C. On day two, second heat treatment was applied by incubating samples at 98 °C for 5 minutes in a water bath. After cooling 10μl proteinase k was added, briefly vertoxed and incubated at 56 °C for overnight. During the whole incubation period samples were put on a shaker at interval for about 30 minutes. Chloroform was then added, the supernatant was collected, and DNA was precipitated by ethanol, dissolved in 100 μl TE storage buffer. The purity and quality of the extracted DNA was analyzed based on absorbance of the extracted DNA at 260 and 280 nm wavelengths using a spectrophotometer (NanoDrop-1000, Thermo Fisher Scientific, and Wilmington, USA).

PCR amplifications of extracted DNA

Before viral amplification, the DNA quality was checked by amplifying a certain region of the glyceraldehyde-3- phosphate dehydrogenase (GAPDH) gene using primers (forward primer 5‘GGCCTCCAAGGAGTAAGACC3‘and reverse primer: 5‘CCCCTCTTCAAGGGGTCTAC3‘). After validation specific regions of the viral genome were amplified by using two primers: Epstein Barr Encoded RNA (EBER) gene (forward primer 5‘CCCTAGTGGTTTCGGACACA3’ and reverse primer 5‘ACTTGCAAATGCTCTAGGCG3’) [12] and Latent Membrane Protein-1 (LMP-1) gene (forward primer: 5′CCGAAGAGGTTGAAAACAAA 3′ and reverse primer 5′GTGGGGGTCGTCATCATCTC 3′) [5]. DNA from EBV-positive nasopharyngeal carcinoma (NPC) was used as a positive control and nuclease-free distilled water was used as a negative control. Electrophoresis of PCR products were done in 2% ethidium bromide-stained agarose gel in TBE buffer at 90 V for 1 h. DNA bands were visualized by a transilluminator (UV doc, England. DNA ladder 100 base pair (bp) (Fermentas-Russia) was used as indicator of band size.

EBER RNA in situ hybridization

In order to localize viral transcript within the tumor cells, 14 samples which were positive by PCR in duplicate assay and which have relatively brighter bands in agarose gel were further tested by ISH technique using PNA ISH detection Kit following the manufacturer’s instruction. Briefly, 4 μ thick FFPE tissue sections on positively charges slides (BioGenex, USA) were deparaffinized in xylene, rehydrated in serial graded ethanol washes, digested with proteinase K and then followed by hybridization of EBV- EBER peptide nucleic acid (PNA) Probe/ Fluorescein (Dako) for 90 minutes at 55°C. Detection was accomplished by alkaline phosphatase (AP)-conjugated anti-fluorescein antibodies using nitro blue tetrazolium (NBT)/BromochloroIndoyl phosphate (BCIP) (Dako) as a substrate. Slides were counterstained with hematoxylin (Chem Cruz, Santa Cruz Biotechnology) and mounted with DPX Mountant (Atom Scientific). Positive and negative controls provided by the manufacturer were used. Section from EBV positive nasopharyngeal carcinoma was used as an additional positive control. A case was considered as expressing EBER if the nucleus of a tumor cell stained dark blue or black.

Immunohistochemistry (IHC) test

Sections of 4 μm thick were cut from 45 paraffin blocks of breast cancer using a microtome and put on coated immunoslides and were de-paraffinized in xylene, rehydrated through series of graded alcohol, submitted to heat retrieval in citrate buffer (pH 6.0) for 40 minutes in water bath. After heating, the slides were allowed to cool to room temperature and washed with phosphate buffered saline (PBS). Endogenous peroxidase activity was blocked with 1% hydrogen peroxide in methanol for 5 minutes blocking serum was used for 1hr in order to block nonspecific immunoreactions. Monoclonal antibodies for LMP2a (Santa Cruz Biotechnology) were applied at a dilution of 1:100 on all tissue sections for overnight at 4°C to evaluate the expression of LMP2a. Detection was performed using Santa Cruz biotechnology envision dual link system according to the manufacturer's instruction. After that, slides were visualized using Santa Cruz liquid DAB. Mayer's hematoxylin was used as a counter stain. As a positive control, we used EBV infected nasopharyngeal carcinoma. In negative controls, the primary antibodies were omitted.

Statistical analysis

Data were entered and analyzed using the software Statistical Package for Social Sciences version 20 (SPSS, Inc., Chicago, IL, USA). Proportions were compared for significance using the Fisher exact test to determine whether there was any significant difference between the frequency of EBV in the carcinoma and the non-cancerous samples and its relationship with breast cancer. A p- value of ≤ 0.05 was considered indicative of a statistically significant difference.

Results

Clinicopathological features

During this study breast cancer samples were collected from 144 patients mean age of 51.48 years (range, 19 to 91 years). The mean age of the controls with fibroadenoma was 26 years (range ). Histological tumor types were: ductal carcinoma 96 (66.66%) (Of which 56 (58.33%) were invasive ductal carcinoma), medullary carcinoma 12 (8.33), lobular carcinoma 2(1.38%) and all other types 34 (23.61%). Lymph node involvement was detected in 35 (24.30%) of all cases (Table 1).

Table 1 Clinicopathological features of breast cancer samples (n=144) from Eritrean patients
Full size table
Fig. 1
figure 1

Detection of EBV in poorly differentiated invasive ductal carcinoma tissue section using EBER-ISH nuclear staining. Epstein-Barr virus-encoded RNA-1 (EBER1) in situ hybridization technique was used on those samples which were relatively more positive by PCR (n = 14) and signal for viral transcripts was observed in 35.71% (5/14). Figure 1a shows a case of poorly differentiated invasive ductal carcinoma exhibiting nuclear positivity indicated by dark staining within malignant cells (arrows). (X 40 objective). Figure. 1b is the hematoxyline and eosin staining of the image in Fig. 1a . (X 40 objective). Figure 1c is a positive control from a case of EBV infected nasopharyngeal carcinoma tissue section showing dark nuclear staining (arrows). (X40 objective)

Full size image

Molecular detection of EBV in breast cancer cases

DNA was successfully extracted from 144 FFPE samples of breast carcinoma patients, and from 63 non- cancerous benign tissues samples. The extracted DNA from FFPE breast cancer tissue was successfully amplified using GAPDH primers indicating good quality DNA for further viral detection assay. Amplification fragments of both LMP1 & EBER were detected using PCR. Combining the two markers a total of 40 (27.77%) of 144 breast cancer samples showed faint bands compared to the band formed by the positive control from a case of nasopharyngeal carcinoma. Repeated trial was done for those samples with faint bands and the result was the same as the first trial. Out of the samples with faint band 33(22.91%) were revealed using EBER and 14 (9.72%) using LMP1. As reviewed by Hou and his team, in three previous studies, the detection potential of EBER was higher than that of LMP1 [30]. Six (9.52%) out of 63 control samples showed very faint bands. Statistically, using EBER marker, association between EBV and breast cancer (P= 0.0031) was observed compared to the control group but the association employing LMP1 marker was not significant (P =0.1563), Fisher's exact test (Table 2).

Table 2 Detection of EBV genome in breast cancer samples by PCR using EBER and LMP-1 primers
Full size table

ISH detection of EBER1 gene transcript

In order to confirm the presence of EBV within the tumor cells, Epstein-Barr virus-encoded RNA-1 (EBER1) in situ hybridization technique was used on those cases which were PCR positive in duplicate trials and/or those showing relatively brighter bands on agarose gel electrophoresis and or those which were positive by two markers (n=14). Signal for viral transcripts was observed in 35.71% (5/14) indicated by its nuclear localization in the tumor cells. Figure 1a shows positive staining of a case of poorly differentiated invasive ductal carcinoma exhibiting nuclear positivity indicated by dark staining in malignant cell. Fig 1b is the hematoxyline and eosin staining of the section in Fig 1a). A tissue section from a case of NPC was used as a positive control (Fig. 1c) and as a negative control a breast cancer section without the primary antibody was employed.

IHC staining for detection of viral protein (LMP2a)

To assess expression of viral protein, IHC assay using LMP2a antibody was performed on 45 samples and LMP2a was expressed in 15.55% (7/45) of which six (13.33%) were also positive for EBV by PCR.

Discussion

Three detection methods: PCR. ISH and IHC were employed in the determination of EBV association with breast cancer. PCR results indicated the presence of EBV genome in 27.77% (n=144) of breast cancer samples amplified using EBER and LMP1 viral DNA fragments. This finding is in line with a metanalysis study in which about 29.32 % of the patients with breast cancer were infected with the virus [30]. In this study the number of EBV positive samples as well as that of EBV infected cells within positive samples were observed to be quite low as indicated by the faint bands on agarose gel and the scarce infected tumor cells in the ISH stained slides as compared to the positive controls from a case of NPC. PCR amplification was repeated for those samples with faint bands and got similar result. It is reported that as low as 0.00004 EBV genomes per infected cell can be detected using quantitative PCR [20] and Perrigoue and his team define ' EBV positive ' as the majority of tumor cells each to contain at least one copy of EBV DNA [19]. In a similar study low level EBV DNA in about 50% of the study breast cancer samples were detected by PCR [31]. EBV positive tumor infiltrating lymphocytes are believed to give false positive results during PCR assay [23, 32]. To rule out this, EBER-ISH technique which is considered as a gold standard technique for detection of EBV [33] was performed and viral transcripts were detected in 35.71% of the 14 stained samples. Fig. 1a shows one of the positive slides revealing nuclear localization of the viral transcript within the tumor cells, though compared to the positive control from a case of NPC (Fig. 1c) the viral copies seems quite low.

Of interest here, from epidemiological point of view, the frequency difference in Eritrean cases in comparison to neighboring Sudan where a frequency as high as 100% EBV infection in breast cancer has been reported [5]. This variation may be influenced by factors such as geographical and immunological differences and ethnicity [15, 34]. Lopategui and his team in their study in cases of sinonasal undifferentiated carcinomas comparing populations from two different regions suggested that genetic predisposition or environmental cofactors play an important role in determining the strength of the association of malignancy with EBV [35]. Similar to the present work, low copy number of EBV in breast cancer is also reported in other studies though, latently EBV infected cells contain massive EBER viral transcripts [36, 37] as is the case in NPC in which the frequency is 100%. Magrath and Bhatia suggested that the presence of EBV genome in only a subset of tumor cells indicates that EBV may infect already formed cancer cell implying its absence in neoplastic clone at the time of malignant transformation, but they do not rule out selective loss of viral genome [32]. Kalkan and his team detected EBV genome in a subset of breast cancer tissues and based on their finding and the findings of other studies, concluded that EBV if it has a role in breast cancer it is only in a limited subset of the cases [38]. In our findings not all PCR positive samples were also positive by ISH. The in concordance between the results of these two assays was previously reported. Richardson and his team reviewed 16 studies that used both ISH and PCR to detect EBV in breast cancer tissue and found out that in nine (56%) of the studies PCR positive cases were negative by ISH [28]. Most of our samples which were EBV-ISH positive were poorly differentiated invasive ductal carcinoma which indicates that the virus may probably have a role in complicating existing tumor. It is known that EBV is usually detected in undifferentiated nasopharyngeal carcinoma [4] and its association with highly invasive breast tumors is also reported [12].

LMP2A is over expressed in 15.55% (n=7) of the 45 breast cancer samples stained by immunostaining. This indicates low frequency of viral protein expression in breast cancer samples from Eritrea. This protein was observed to be expressed in about half of the samples from NPC and is mainly localized at the tumor invasive front [39].

EBV is one of the most successful pathogens to establish perfect host pathogen equilibrium and lives latently without too much interfering into the health of humans and according to some authors [40, 41] its carcinogenic effect is the outcome of its coordination with other cofactors. Even in its well established association with lymphomas it is mainly detected in immunodeficiency state and is known as a ubiquitous virus which usually causes cancer in immune suppressed individuals [42]. Some authors believe that, pathogenesis of EBV may be of significance only in the presence of environmental carcinogens or pre-existing epithelial damage [32].

Interestingly, EBV genome was also detected in six (9.52%) out of a total 63 controls (fibroadenomas). One sample was also positive by IHC for LMP2a protein and another one was positive by EBER-ISH. The role of EBV in the pathogenesis of fibroadenoma is suggested in a study performed on immunosuppressed individuals [43]. In another study benign breast tissues were positive for EBV DNA [38] and it is reported to infect non- cancerous gastric epithelium such as atrophic gastric mucosa which may progress to cancer [44, 45]. Further study is required for the role of EBV in non-cancerous breast tissues such as fibroadenomas.

In this study, even if the viral genome was detected within tumor epithelial cells and the low copy number was accepted as having a role in pathophysiology of the disease; majority of our test samples were free of the viral genome. The loss of viral genome during tumor development due to ‘Hit and run’ hypothesis was previously suggested [46] but have doubt as whether this can explain the whole scenario. Thus, in this study, though there seems to be an association of EBV with breast cancer, considering the low number of infected samples and low viral copy number in each infected samples, it is difficult to generalize the viral casual role.

Conclusion

Based on the present finding which showed very low frequency of EBV in breast cancer tumors as well as low viral copy number within positive tumors, it can be concluded that though there could probably be some sort of association between EBV and breast cancer, its role as prime tumor initiator in breast cancer in Eritrea seems less probable. Further studies are required to determine the role of the few infected cells in carcinogenesis as well as tumor progression and the epidemiological cofactors which impact on EBV association with breast cancer in Eritrea.

Abbreviations

EBER:

Epstein Barr Encoded RNA

EBV:

Epstein-Barr virus

FFPE:

Formalin fixed paraffin- embedded

GAPDH:

Glyceraldehyde-3-phosphate-dehydrogenase

IARC:

International Agent for Research in Cancer

IHC:

Immunohistochemistry

ISH:

In situ hybridization

LMP-1:

Latent Membrane Protein-1

LMP2a:

Latent Membrane Protein-2a

NPC:

Nasopharyngeal carcinoma

PCR:

Polymerase chain reaction

References

  1. Ferlay J, Soerjomataram I, Ervik M, Dikshit R, Eser S, Mathers C, et al. GLOBOCAN 2012 v1.0 Cancer Incidence and Mortality Worldwide: IARC Cancer Base No. 11. Lyon France: International Agency for Research on Cancer; 2013. Available from: http://globocan.iarc.fr accessed on 10/8/2016.

  2. Fregene A, Newman LA. Breast cancer in sub-Saharan Africa: how does it relate to breast cancer in African-American women? Cancer. 2005;103:1540–50.

    Article  PubMed  Google Scholar 

  3. Pogo BG, Holland JF. Possibilities of a viral etiology for human breast cancer. Biol Trace Elem Res. 1997;56:131–42.

    Article  CAS  PubMed  Google Scholar 

  4. Tang W, Harmon P, Gulley ML, Mwansambo C, Kazembe PN, Martinson F. Viral Response to Chemotherapy in Endemic Burkitt Lymphoma. Clin Cancer Res. 2010;16(7):2055–64.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Yahia ZA, Adam AA, Elgizouli M, Hussein A, Masri MA, Kamal M, Ibrahim ME. Epstein Barr virus: a prime candidate of breast cancer aetiology in Sudanese patients. Infect Agent Cancer. 2014;9:9.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Schooley RT. Epstein-Barr Virus (Infectious Mononucleosis). In: Mandell GL, Bennett JE, Dolin R, editors. Mandell, Douglas, and Benett’s principles and practice of infectious diseases vol 2. 4th ed. New York, N.Y: Churchill Livingstone; 1995. p. 1364–77.

    Google Scholar 

  7. Pegtel DM, Middeldorp J, Thorley-Lawson DA. Epstein-Barr virus infection in ex vivo tonsil epithelial cell cultures of asymptomatic carriers. J Virol. 2004;78(22):12613–24.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Rickinson AB, Kieff E. Epstein-Barr virus. In: Fields BN, Knipe DM, Howley PM, editors. Virology. 3rd ed. New York, N.Y: Raven Press; 1996. p. 2397–446.

    Google Scholar 

  9. Epstein-barr IARC. virus and Kaposi‘s sarcoma herpesvirus/Human herpesvirus 8. IARC Monogr Eval Carcinog Risks Hum. 1997;70:1–492.

    Google Scholar 

  10. Labrecque LG, Barnes DM, Fentiman IS, Griffin BE. Epstein-Barr virus in epithelial cell tumors: a breast cancer study. Cancer Res. 1995;55:39–45.

    CAS  PubMed  Google Scholar 

  11. Lespagnard L, Cochaux P, Larsimont D, Degeyter M, Velu T, Heimann R. Absence of Epstein-Barr virus in medullary carcinoma of the breast as demonstrated by immunophenotyping in situ hybridization and polymerase chain reaction. Am J Clin Pathol. 1995;103:449–52.

    Article  CAS  PubMed  Google Scholar 

  12. Bonnet M, Guinebretiere JM, Kremmer E, Grunewald V, Benhamou E, Contesso G. Detection of Epstein-Barr virus in invasive breast cancers. J Natl Cancer Inst. 1999;91:1376–81.

    Article  CAS  PubMed  Google Scholar 

  13. Joab I. Detection of Epstein–Barr virus in invasive breast cancers. J Natl Cancer Inst. 2000;92:656.

    Article  CAS  Google Scholar 

  14. Angeloni A, Farina A, Gentile G, Capobianchi A, Martino P, Visco V. Epstein-Barr virus and breast cancer: search for antibodies to the novel BFRF1 protein in sera of breast cancer patients. J Natl Cancer Inst. 2001;93:560–1.

    Article  CAS  PubMed  Google Scholar 

  15. Fina F, Romain S, Ouafik L, Palmari J, Ayed FB, Benharkat S, et al. Frequency and genome load of Epstein-Barr virus in 509 breast cancers from different geographical areas. Br J Cancer. 2001;84(6):783–90.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Murray PG, Young LS. Epstein–Barr virus infection: basis of malignancy and potential for therapy. Exp Rev Mol M Med. 2001;3(28):1–20.

    CAS  Google Scholar 

  17. Deshpande CG, Badve S, Kidwai N, Longnecker R. Lack of expression of the Epstein-Barr virus (EBV) gene products EBERs EBNA1 LMP1 and LMP2A in breast cancer cells. Lab Investig. 2002;82:1193–9.

    Article  CAS  PubMed  Google Scholar 

  18. Hermann K, Niedobitek G. Lack of evidence for an association of Epstein- Barr virus infection with breast carcinoma. Breast Cancer Res. 2003;5:R13–7.

    Article  Google Scholar 

  19. Perrigoue JG, den Boon JA, Friedl A, Newton MA, Ahlquist P, Sugden B. Lack of association between EBV and breast carcinoma. Cancer Epidemiol Biomark Prev. 2005;14:809–14.

    Article  CAS  Google Scholar 

  20. Perkins RS, Sahm K, Marando C, Witmer DD, Pahnke GR, Mitchell M. Analysis of Epstein-Barr virus reservoirs in paired blood and breast carcinoma primary biopsy specimens by real time PCR. Breast Cancer Res. 2006;8: R70.’

  21. Joshi D, Quadri M, Gangane N, Joshi R, Gangane N. Association of Epstein Barr Virus Infection (EBV) with Breast Cancer in Rural Indian Women. PLoS One. 2009;4(12):e8180.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Lorenzetti MA, De Matteo E, Gass H, Martinez Vazquez P, Lara J, Gonzalez P, et al. Characterization of Epstein Barr Virus Latency Pattern in Argentine Breast Carcinoma. PLoS One. 2010;5(10):e13603.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Khan G, Philip PS, Al Ashari M, Houcinat Y, Daoud S. Localization of Epstein-Barr virus to infiltrating lymphocytes in breast carcinomas and not malignant cells. Exp Mol Pathol. 2011;91(1):466–70.

    Article  CAS  PubMed  Google Scholar 

  24. Mazouni C, Fina F, Romain S, Ouafik L, Bonnier P, Brandone JM, Martin PM. Epstein-Barr virus as a marker of biological aggressiveness in breast cancer. Br J Cancer. 2011;104(2):332–7.

    Article  CAS  PubMed  Google Scholar 

  25. Fadavi P, Rostamian M, Arashkia A, Shafaghi B, Niknam HM. Epstein- barr virus may not be associated with breast cancer in Iranian patients. Oncol Discov. 2013;1:3.

    Article  Google Scholar 

  26. Glaser SL, Hsu JL, Gulley ML. Epstein-barr virus and breast cancer: state of the evidence for viral carcinogenesis. Cancer Epidemiol Biomark Prev. 2004;13(5):688–97.

    CAS  Google Scholar 

  27. Lorenzetti MA, Gantuz M, Altcheh J, De Matteo E, Chabay PA, Preciado MV. Distinctive Epstein-Barr Virus Variants Associated with Benign and Malignant Pediatric Pathologies: LMP1 Sequence Characterization and Linkage with Other Viral Gene Polymorphisms. J Clin Microbiol. 2012;50(3):609–18.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Richardson AK, Currie MJ, Robinson BA, Morrin H, Phung Y, Pearson JF. Cytomegalovirus and Epstein - Barr virus in Breast Cancer. PLoS One. 2015;10(2):e0118989.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Khabaz MN. Association of Epstein-Barr virus infection and breast carcinoma. Arch Med Sci. 2013;9(4):745–51.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Huo Q, Zhang N, Yang Q. Epstein-Barr Virus Infection and Sporadic Breast Cancer Risk: A Meta-Analysis. PLoS One. 2012;7(2):e31656.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Arbach H, Viglasky V, Lefeu F, Guinebretière JM, Ramirez V, Bride N. Epstein-Barr Virus (EBV) Genome and Expression in Breast Cancer Tissue: Effect of EBV Infection of Breast Cancer Cells on Resistance to Paclitaxel (Taxol). J Virol. 2006;80(2):845–53.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Magrath I, Bhatia K. Breast cancer: a new Epstein–Barr virus-associated disease. J Natl Cancer Inst. 1999;91(16):1349–50.

    Article  CAS  PubMed  Google Scholar 

  33. Chang KL, Chen YY, Shibata D, Weiss LM. Description of an in situ hybridization methodology for detection of Epstein-Barr virus RNA in paraffin- embedded tissues with a survey of normal and neoplastic tissues. Diagn Mol Pahol. 1992;1:246–55.

    Article  CAS  Google Scholar 

  34. Thompson MP, Kurzrock R. Epstein-Barr virus and cancer. Clin Cancer Res. 2004;10:803–21.

    Article  CAS  PubMed  Google Scholar 

  35. Lopategui JR, Gaffey MJ, Weiss LM. Detection of Epstein-Barr viral RNA in sinonasal undifferentiated carcinoma from Western and Asian patients. Am J Surg Pathol. 1994;18:391–8.

    Article  CAS  PubMed  Google Scholar 

  36. TC W, Mann RB, Epstein JL, MacMahon E, Lee WA, Charache P, et al. Abundant expression of EBER1 small nuclear RNA in nasopharyngeal carcinoma. A morphologically distinctive target for detection of Epstein-Barr virus in formalin-fixed paraffin-embedded carcinoma specimens. Am J Pathol. 1991;138:1461–9.

    Google Scholar 

  37. Gulley ML. Molecular diagnosis of Epstein-Barr virus related diseases. J Mol Diagn. 2001;3(1):1–10.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Kalkan A, Ozdarendeli A, Bulut Y, Yekeler H, Cobanoglu B, Doymaz MZ. Investigation of Epstein-Barr virus DNA in Formalin-Fixed and Paraffin- Embedded Breast Cancer Tissues. Med Princ Pract. 2005;14:268–71.

    Article  PubMed  Google Scholar 

  39. Kong QL, LJ H, Cao JY, Huang YJ, LH X, Liang Y, et al. Epstein-Barr Virus- Encoded LMP2A Induces an Epithelial–Mesenchymal Transition and Increases the Number of Side Population Stem-like Cancer Cells in Nasopharyngeal Carcinoma. PLoS Pathog. 2010;6(6):e1000940–10.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Griffin B. Epstein-Barr virus (EBV) and human disease: Facts opinions and problems. Mutat Res. 2000;462:395–405.

    Article  CAS  PubMed  Google Scholar 

  41. Crawford DH. Biology and disease associations of Epstein-Barr virus. Philos Trans R Soc Lond. 2001;356:461–73.

    Article  CAS  Google Scholar 

  42. Raab-Traub N. Pathogenesis of Epstein–Barr virus and its associated malignancies. Semin Virol. 1996;7:315–23.

    Article  CAS  Google Scholar 

  43. Kleer CG, Tseng MD, Gutsch DE, Rochford RA, Wu Z, Joynt LK, et al. Detection of Epstein-Barr virus in rapidly growing fibroadenomas of the breast in immune suppressed hosts. Mod Pathol. 2002;15(7):759–64.

    Article  PubMed  Google Scholar 

  44. Arikawa J, Tokunaga M, Tashiro Y, Tanaka S, Sato E, Haraguchi K. Epstein-Barr virus-positive multiple early gastric cancers and dysplastic lesions: a case report. Pathol Int. 1997;47:730–4.

    Article  CAS  PubMed  Google Scholar 

  45. Yanai H, Takada K, Shimizu N, Mizugaki Y, Tada M, Okita K. Epstein-Barr virus infection in non-carcinomatous gastric epithelium. J Pathol. 1997;183:293–8.

    Article  CAS  PubMed  Google Scholar 

  46. Ambinder RF. Gamma herpes viruses and hit and run oncogenesis. Am J Pathol. 2000;156:1–3.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

The authors express their appreciation to the Department of Histopathology, National Health Laboratory; Department of Surgery, Orotta Referral Hospital; and Keren Referral Hospital, Ministry of Health, Eritrea for granting us permission to collect samples from their respective facilities. We thank Dr. Babikir Ishag Mohamed Fadul, Radiation and Isotope Center, Khartoum, for initially reading the ISH stained slides.

Funding

This study was funded by African Developing Bank (ADB) through the National Commission for Higher Education, Eritrea.

Availability of data and materials

Not applicable

Author information

Authors and Affiliations

  1. Department of Molecular Biology, Institute of Endemic Diseases, University of Khartoum, Al-Qasr Street, P.O. Box 102, Khartoum, Sudan

    Ghimja Fessahaye, Ahmed M. Elhassan & Muntaser E. Ibrahim

  2. Faculty of Medical Laboratory Sciences, Alzaeim Alazhari University, Khartoum, Sudan

    Elwaleed M. Elamin

  3. Faculty of Medical Laboratory Sciences, Department of Histopathology and Cytology, Al Neelain University, Khartoum, Sudan

    Ameera A. M. Adam

  4. Asmera College of Health Sciences, Asmara, Eritrea

    Ghimja Fessahaye & Anghesom Ghebremedhin

Authors
  1. Ghimja Fessahaye
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Ahmed M. Elhassan
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Elwaleed M. Elamin
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Ameera A. M. Adam
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Anghesom Ghebremedhin
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Muntaser E. Ibrahim
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

GF & MI conceived of the study idea and wrote the manuscript; GF performed laboratory experiments data analysis; AG participated in sample collection and analysis of the 10 years breast cancer data, AME and AAMA analyzed the In situ hybridization stained slides and. EME analyzed the immunochemistry stained slides. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Muntaser E. Ibrahim.

Ethics declarations

Authors’ information

GF, PhD in molecular biology, Asmara College of Health Sciences, Eritrea. AME, Emeritus professor of pathology, Institute of Endemic Diseases, University of Khartoum, Khartoum, Sudan, EME, Faculty of Medical Laboratory Sciences, Alzaeim Alazhari University, Khartoum, Sudan. AAMA. PhD in Molecular Biology, Department of Molecular Biology, Institute of Endemic Diseases, University of Khartoum, Khartoum, Sudan. AG, Graduate assistant, Asmara College of Health Sciences, MEI, Professor of genetics, Department of molecular biology, Institute of Endemic Diseases, University of Khartoum, Khartoum, Sudan

Ethics approval and consent to participate

This research was approved by the ethical committee of the Ministry of Health, Eritrea and that of the Institute of Endemic diseases, University of Khartoum, Sudan.

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Fessahaye, G., Elhassan, A.M., Elamin, E.M. et al. Association of Epstein - Barr virus and breast cancer in Eritrea. Infect Agents Cancer 12, 62 (2017). https://doi.org/10.1186/s13027-017-0173-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13027-017-0173-2

Keywords

Infectious Agents and Cancer

ISSN: 1750-9378

Contact us