Skip to main content

Table 2 Primer sequences and location in the MMTV env gene

From: Prevalence and characteristics of mouse mammary tumor virus-like virus associated breast cancer in China

Designation Sequence(5′-3′) Location
J948-env-F CCTCACTGCCAGATCGCCTT 6048–6067
J950-env-R CAGGTAGCAGCACATATGGC 6629–6648
J1011-env-R1 CCTGCTTCATACCATCGATGAACC 6278–6301
IDD428-GAPDH-F GGAGTCAACGGATTTGGT  
IDD429-GAPDH-R GTGATGGGATTTCCATTGAT