Skip to main content

Table 2 Nucleotide sequences of primers used for real-time RT-PCR

From: Evaluating the expression level of HERV-K env, np9, rec and gag in breast tissue

GeneForward primer (5′-3′)Reverse primer (5′-3′)
GAPDHATGTTCGTCATGGGTGTGAAGGTGCTAAGCAGTTGGTGGT
recATCGAGCACCGTTGACTCACAAGAGGTACACCTGCAGACACCATTGAT
np9AGATGTCTGCAGGTGTACCCACTCTTGCTTTTCCCCACATTTC
envTAACCCTGTCACTTGGATTATGTCACTGTCTCTTCGG
gagAGCAGGTCAGGTGACCGTAACGGTGCCATAGCATTGTCTCCT