Skip to main content

Table 1 Primers used in this study

From: High-risk type human papillomavirus infection and p16 expression in laryngeal cancer

PCR primer Sequence (5′–3′)
GP5+ TTTGTTACTGTGGTAGATACTAC
GP6+ GAAAAATAAACTGTAAATCATATTC
MY09 CGTCCMARRGGAWACTGATC
MY11 GCMCAGGGWCATAAYAATGG
PC04 CAACTTCATCCACGTTCACC
GH20 GAAGAGCCAAGGACAGGTAC
Real-time PCR primer and TaqMan probe Sequence (5′–3′)
E2-F AACGAAGTATCCTCTCCTGAAATTATTAG
E2-R CCAAGGCGACGGCTTTG
E2-Probe FAM-CACCCCGCCGCGACCCATA-TAMRA
E6-F GAGAACTGCAATGTTTCAGGACC
E6-R TGTATAGTTGTTTGCAGCTCTGTGC
E6-Probe FAM-CAGGAGCGACCCAGAAAGTTACCACAGTT-TAMRA
β-globin-F TGGGTTTCTGATAGGCACTGACT
β-globin-R AACAGCATCAGGAGTGGACAGAT
β-globin-Probe FAM-TCTACCCTTGGACCCAGAGGTTCTTTGAGT-TAMRA
β-actin-F GCGAGAAGATGACCCAGATC
β-actin-R CCAGTGGTACGGCCAGAGG
β-actin-Probe FAM-CCAGCCATGTACGTTGCTATCCAGGC-TAMRA
  1. F Forward; R Reverse