Skip to main content


Table 1 Target gene, sequence and expected product size

From: Prevalence of CagA and antimicrobial sensitivity of H. pylori isolates of patients with gastric cancer in Egypt

Primers Sequence (5′ → 3′) Product size References
glmM-F GCATTCACAAACTTATCCCCAATC 140 bp Espinoza et al. (2011) [55]
CagA- F AATACACCAACGCCTCCAAG 496 bp Izadi et al. (2012) [56]