Skip to main content

Table 2 Oligonucleotide primers

From: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR

Pair Primer Sequence (5'→3') Amplicon
1 LCRS (Forward) AAGGGAGTAACCGAAAACGGT E6-1 (645 bp)
  E7AS (Reverse) TCATCCTCCTCCTCTGAG  
2 pU1M (Forward) TGTCAAAAACCGTTGTGTCC E6-2 (237 bp)
  pU2R (Reverse) GAGCTGTCGCTTAATTGCTC