Somatic mutations of STK11 gene in human papillomavirus positive and negative penile cancer

  • Clorinda Annunziata1,

    Affiliated with

    • Luigi Buonaguro1,

      Affiliated with

      • Simona Losito2,

        Affiliated with

        • Franco M Buonaguro1 and

          Affiliated with

          • Maria Lina Tornesello1Email author

            Affiliated with

            Infectious Agents and Cancer20138:2

            DOI: 10.1186/1750-9378-8-2

            Received: 13 December 2012

            Accepted: 7 January 2013

            Published: 10 January 2013

            Abstract

            Background

            Human papillomavirus (HPV) infection accounts for about 40-50% of all cases of penile carcinoma suggesting that other factors, including host genetic status, are involved in neoplastic transformation. In this perspective, STK11 gene, which has been found frequently mutated in HPV-related cervical carcinoma, has been analyzed in HPV-positive and HPV-negative invasive penile cancers to establish its mutational status and the possible correlation of HPV infection with specific genetic alterations.

            Methods

            Genomic DNAs extracted from 26 cases of penile squamous cell carcinoma were analyzed for genetic alterations in the exons 1 to 9 of STK11 gene by quantitative real-time PCR. Ratios of potentially deleted and non-deleted exons were indicative of specific loss of STK11 coding regions. DNA samples of 5 cancer cases were subjected to standard PCR amplification of STK11 exons 1 to 9 and analyzed for somatic mutations by direct nucleotide sequencing analysis.

            Results

            Heterozygous deletions of STK11 exon 1 and 2 were identified in 2 out of 14 HPV-positive (14.3%) and 1 out of 12 HPV-negative cases (8.3%). Complete nucleotide sequencing analysis of exons 1 to 9 showed a single nucleotide change upstream the exon 2 coding region in 1 out of 5 penile carcinoma samples.

            Conclusions

            The present results suggest that single nucleotide mutations and/or deletions of STK11 gene are rare events in penile cancer. Moreover, no significant association was observed between STK11 alterations and HPV infection in these tumors.

            Keywords

            HPV STK11 Somatic mutations Penile cancer

            Background

            Penile cancer is a rare malignancy in Western Europe and the United States with age-standardized incidence rates (ASR) of 0.1-1.5 per 100,000 men. In Africa, Asia and South America, however, the estimate ASRs are significantly higher with peaks of 2.8 and 3.7 per 100,000 men, in Uganda and Brazil, respectively [1].

            The most common histological type of penile carcinoma is the squamous cell carcinoma (95%) which comprises several subtypes such as usual squamous cell carcinoma(48-65%), basaloid (4-10%), warty (7-10%), verrucous (3-8%), papillary (5-15%) and mixed carcinoma (9-10%) [2]. Although the etiology of penile cancer is not yet fully understood several risk factors, such as poor hygiene and phimosis, lack of circumcision in childhood and history of smoking, have been shown to increase the risk to develop this malignancy [36]. Human papillomaviruses (HPV) have been associated with approximately 47% of invasive penile carcinoma cases with HPV16 and HPV18 as the most common viral genotypes accounting for 60.23% and 13.35%, respectively, of the HPV attributable cases [7]. Higher rates of HPV positivity have been found in warty-basaloid (82%), basaloid (76%), and warty carcinomas (39%). This observation was indicative of a strong association between the basaloid cell type and presence of HPV [8].

            Several studies have reported genetic alterations in tumor suppressor genes and oncogenes, in both HPV-positive and HPV-negative penile cancers, which may have a critical role in tumor carcinogenesis [9, 10]. STK11 is a 23 kb tumor suppressor gene, mapped to chromosome 19p13.3, which encodes for the serine/threonine kinase 11 (STK11) also known as liver kinase B1 (LKB1) or renal carcinoma antigen NY-REN-19 [11, 12]. The STK11 gene is widely expressed in embryonic and adult tissues and the encoded STK11 kinase is an essential regulator of chromatin remodeling, cell cycle arrest, p53-dependent apoptosis, Wnt signaling, cell polarity and energy metabolism [1315]. Germ-line mutations of the STK11 gene are associated with Peutz-Jeghers syndrome (PJ) [11, 12], an autosomal dominant disorder characterized by hamartomatous polyps of the gastrointestinal tract and by a considerably increased risk of cancer in gastrointestinal tract, pancreas, breast, lung, uterus, cervix, ovary and testis [1618]. PJ patients are at increased risk to develop cancer particularly at body sites with higher levels of STK11 enzyme in the normal tissue [19].

            Somatic mutations of STK11gene have been frequently found in several sporadic tumors, including HPV-related cervical cancer [2025]. No studies have been performed on STK11 mutational status in penile carcinoma.

            The aim of the present study was to analyze genetic alterations and single nucleotide mutations in exons 1 to 9 of STK11 gene in HPV-positive and HPV-negative penile cancers to possibly establish a relationship between HPV infection and genetic alterations involved in cancer progression.

            Methods

            Samples and DNA isolation

            This study included DNA samples extracted from liquid-nitrogen frozen specimen of penile squamous cell carcinoma (n = 6) from Black Ugandan patients and paraffin-embedded penile squamous cell carcinoma (n = 20) from Caucasian Italian patients. These samples were previously characterized in terms of histology, DNA quality, HPV genotypes, HPV16 variants and viral integration status [9, 26]. The study protocol was approved by the ethical review board of the involved Institution. Genomic DNA was extracted from frozen biopsies as well as from thin sections of fixed and embedded tissues according to published procedures [27, 28]. In particular two 10 μm sections of each biopsy were extracted twice with 1 ml of xylenes, for paraffin removal, and twice with 500 μl of 100% ethanol, for organic solvents removal. Both xylenes-treated and fresh tissue samples were digested with Proteinase K (150 μg per ml at 60°C for 30 min) in 100-500 μl lysis buffer (10 mM Tris-HCl pH 7.6, 5 mM EDTA, 150 mM NaCl, 1% SDS), followed by DNA purification by phenol and phenol-chloroform-isoamyl alcohol (25:24:1) extraction and ethanol precipitation in 0.3 M sodium acetate (pH 4.6). Genomic DNA was also extracted from PC23, HeLa and SiHa cell lines to be used as positive and negative control, respectively, in the PCR and real time PCR.

            Quantitative real-time PCR

            Exons 1 to 9 of STK11 gene were independently amplified by real time polymerase chain reaction (PCR) using primer sequences listed in Table  1. The nine primer pairs have been designed with Beacon Designer 7.9 (Bio Rad Laboratories, Inc). All STK11 exons were amplified in a total volume of 25 μl containing iQ SYBR Green Supermix containing 50 mM KCl, 20 mM Tris-HCl, pH 8.4, 0.2 mM of each dNTP and 25 units/ml iTaq DNA polymerase, 3 mM MgCl2, 10 nM SYBR Green I (Bio-Rad Laboratories, Inc), 3 μmol/L of each primer, and 100 ng - 500 ng of genomic DNA. All experiments were performed on the CFX96 Real Time System (Bio-rad Laboratories, Inc). The specificity of amplification was confirmed applying dissociation analysis starting at 65°C.
            Table 1

            Primer sequences used for PCR, nucleotide sequence analysis and Real-time PCR amplification of STK11 exons 1 to 9

            Region

            Forward (5’-3’)

            Reverse (5’-3’)

            Product length

            Annealing temperature (°C)

            STK11 exon 1

            ACAATCGTTTCTGTTGGAAG

            TCCTTGTGTTCCGACTTC

            113 bp

            55

            STK11 exon 2

            CTCTAGGGAAGGGAGGAG

            TTTCTGCTTCTCTTCGTTG

            201 bp

            61

            STK11 exon 3

            TGAGCTGTGTGTCCTTAG

            CACTGGGAAACGCTTCTC

            102 bp

            60

            STK11 exon 4

            CCCGCAGGTACTTCTGTC

            GTGGTGAGCAGCAGGTTC

            100 bp

            61

            STK11 exon 5

            CCTGAGGGCTGCACGGCACC

            GGGGCGGGGCACTTACAGG

            180 bp

            69

            STK11 exon 6

            TCGAAATGAAGCTACAACATC

            TTTCAGCAGGTCAGAGAG

            138 bp

            61

            STK11 exon 7

            TTCTCCTCAGGGATGCTTG

            CACCTGTGCTGCCGGATC

            71 bp

            60

            STK11 exon 8

            ATGACTGTGGTGCCGTAC

            CCGTGAAGTCCTGAGTGTAG

            100 bp

            61

            STK11 exon 9

            CAGGACAGGTCCCAGAAGAG

            CCAGCCTCACTGCTGCTT

            203 bp

            67

            A 5-log dilution series of genomic DNA, extracted from the cell line PC23 [29], were amplified in each experiment for the construction of an absolute standard curve. This curve was used to determine the copy number of exon 1(test) and exon 7 (reference) of STK11 gene in the unknown samples. All PCR reactions were set up in duplicate.

            Deletions of STK11 regions were verified by calculating the ratios (R) of potentially deleted and non-deleted exons. Values of R between 0 and 0.3 and between 0.4 and 0.7 are assumed to be indicative of homozygous or heterozygous deletions, respectively; values of R between 0.8 and 1.2 indicate no changes of the copy number in the two exons.

            Mutation analysis of STK11 gene

            Exons 1 to 9 of STK11 gene were independently amplified by polymerase chain reaction (PCR). All primer sets, described in Table  1, were used to perform standard PCR reactions in 50 μl reaction mixture containing 100–500 ng of target DNA, Hot Master buffer containing 2.5 mM MgCl2, 20 pmol of each primer, 200 μM of dNTPs mix and 1.25 units of thermostable Taq DNA polymerase (5-Prime GmbH, Hamburg, DE). DNA was amplified in a Perkin-Elmer GenAmp PCR System 9700 thermal cycler with the following steps: an initial 2 min denaturation at 94°C, followed by 36 cycles of 30 s at 94°C, 30 s at the annealing temperature specified in Table.  1, 72°C for 30 s, and a final elongation at 72°C for 5 min. A reaction mixture without template DNA was included in each PCR run, as negative control. All products were analyzed by electrophoresis on 7% plyacrylamide gels to verify the specificity of the PCR product. Amplimers of STK11 exons 1–9 from 5 samples were subjected to automated direct nucleotide sequence analysis at Primm Laboratories (Milan, IT) using the same primers used for PCR amplification. STK11 mutations were sought by comparison analysis with the NG_007460.1 reference sequence present in the GenBank.

            Results

            Fourteen HPV-positive (53.9%) and twelve HPV-negative (46.2%) penile squamous cell carcinoma samples were analyzed for genetic alterations by real-time PCR using specific primer sets designed to individually amplify exons 1 to 9. While exons 3 to 9 were always amplified, exons 1 and 2 were not efficiently amplified in 3 out of 26 (11.5%) samples. All 26 samples were subjected to a further quantitative real-time PCR using primer pairs specific for exon 1 (test) and for exon 7 (reference) to determine an absolute quantification of genomic equivalents of exon 1 and exon 7 in each sample. A 5-log dilution series of genomic DNA, extracted from the cell line PC23, was also amplified in the same reaction set to obtain an amplification standard curve (Figure  1). As expected, in 23 out of 26 samples the ratio of exon 1/exon 7 copy number was R ≥ 0.8, indicating no deletions in exon 1. In three out of 26 cases the ratio of exon 1/exon 7 was R ≈ 0.5, indicating the presence of an heterozygous deletion in the test exon. In particular, STK11 deletions were identified in 2 out of 14 HPV positive (14.3%) and 1 out of 12 HPV-negative cases (8.3%) (Table  2). All three STK11 deleted cases were of Italian origin.
            http://static-content.springer.com/image/art%3A10.1186%2F1750-9378-8-2/MediaObjects/13027_2012_419_Fig1_HTML.jpg
            Figure 1

            Quantitative Real-time PCR of exon 1 and exon 7 of STK11 gene in penile cancers. Amplification of exon 1 (A) and exon 7 (C) of STK11 gene. Standard curves of 5-log dilution genomic DNA (PC23 cell line) used to determine the copy number of exon 1(B) and exon 7 (D) of STK11 gene in the unknown samples.

            Table 2

            List of penile cancer samples analysed for exon’s deletions

            Sample

            HPV

            Exon 1 copy number

            Exon 7 copy number

            Exon 1/Exon 7 ratio

            Change of exon 1 copy number

            Origin

            PC04

            HPV16

            3.0 × 104

            3.1 × 104

            1

            no change

            Uganda

            PC07

            HPV16

            3.6 × 104

            3.5 × 104

            1

            no change

            Uganda

            PC08

            HPV16

            2.1 × 103

            2.2 × 103

            1

            no change

            Uganda

            PC15

            HPV16

            4.0 × 104

            4.2 × 104

            1

            no change

            Uganda

            PC17

            HPV16

            2.8 × 103

            2.7 × 103

            1

            no change

            Uganda

            PC23

            HPV16

            4.0 × 103

            3.8 × 103

            1.1

            no change

            Uganda

            PC30

            HPV16

            480

            457

            1.1

            no change

            Italy

            PC31

            Negative

            648

            651

            1

            no change

            Italy

            PC32

            HPV16

            787

            840

            0.9

            no change

            Italy

            PC33

            Negative

            637

            765

            0.8

            no change

            Italy

            PC34

            Negative

            838

            943

            0.9

            no change

            Italy

            PC35

            HPV 18

            487

            847

            0.5

            heterozygous deletion

            Italy

            PC36

            HPV16

            950

            975

            1

            no change

            Italy

            PC37

            HPV16

            655

            645

            1

            no change

            Italy

            PC38

            HPV16

            780

            795

            1

            no change

            Italy

            PC79

            HPV16

            501

            495

            1

            no change

            Italy

            PC80

            Negative

            457

            432

            1.1

            no change

            Italy

            PC81

            Negative

            380

            347

            1.1

            no change

            Italy

            PC82

            Negative

            468

            310

            1.4

            no change

            Italy

            PC84

            Negative

            930

            971

            1

            no change

            Italy

            PC85

            HPV56/54

            172

            316

            0.5

            heterozygous deletion

            Italy

            PC90

            Negative

            215

            475

            0.4

            heterozygous deletion

            Italy

            PC91

            Negative

            697

            846

            0.8

            no change

            Italy

            PC92

            Negative

            461

            553

            0.8

            no change

            Italy

            PC93

            Negative

            738

            643

            1.1

            no change

            Italy

            PC94

            Negative

            806

            780

            1

            no change

            Italy

            Moreover, nucleotide sequencing analysis of the whole coding region (exons 1 to 9) of STK11 gene was performed in 5 samples. A single nucleotide mutation, consisting of C to T transition at position 17587 in the intronic region 2 was detected in one case from Uganda out of 5 (20%) total samples analyzed (Figure  2).
            http://static-content.springer.com/image/art%3A10.1186%2F1750-9378-8-2/MediaObjects/13027_2012_419_Fig2_HTML.jpg
            Figure 2

            DNA sequence electropherogram showing C to T transition at nucleotide 17587 in intron 2 of STK11 gene.

            Discussion

            The knowledge of genetic alterations in penile cancer is limited. In this study we investigated STK11 somatic mutations in both HPV-positive and HPV-negative penile squamous cell carcinoma cases, in order to verify a potential role of this tumor suppressor gene in penile tumorigenesis. The results obtained in our study showed that STK11 exon 1 and 2 are deleted in 11.5% of penile cancers. In particular, heterozygous deletions of STK11 exons 1 and 2 were observed in 14.3% of HPV-positive and in 8.3% of HPV-negative tumors, indicating that HPV status has no effect on the genetic alteration of STK11 gene.

            Genetic alterations of STK11gene have been identified in many sporadic cancers and derived cell lines, including HPV-related cervical carcinoma. In particular, Wingo et al. showed that up to 20% of cervical cancers harbored somatic mutations in STK11 coding regions, of which approximately one-half were single nucleotide substitutions or small deletions while the other half consisted of larger monoallelic or biallelic deletions [25]. Moreover they showed that the inactivation of this gene was associated with accelerated disease progression. Furthermore, an homozygous deletion of whole or of part of STK11gene was observed in SiHa and HeLa cell line [24, 25].

            The nucleotide sequence analysis of exons 1 to 9 of STK11 in 5 penile carcinoma cases showed no somatic mutations in none of the 9 coding regions. A single nucleotide substitution was identified in the intron 2 of one cancer case, however it seems to have no effect on the expression of the protein. Somatic mutations, affecting conserved residues within the kinase domain or intron/exon junctions of STK11, were previously identified in 4 out of 6 cases (66.7%) of cervical adenocarcinomas and 2 out of 10 cases (20%) of squamous cell carcinomas, indicating that single nucleotide substitutions are frequent events in a specific histological subtype of cervical cancer [25].

            Very few studies are available on somatic mutations of other genes in penile carcinoma. A recent report showed a dysregulation of phosphatidylinositol 3-kinase and Ras pathways through somatic alterations of the PIK3CA, HRAS and KRAS genes in 11 out of 28 (39%) penile cancer samples, without any statistically significant difference between HPV-positive and HPV-negative cases [30].

            Other studies analyzing genetic alterations in TP53 gene of penile carcinomas reported mutations in fractions varying from 8% to 33% of the cases [3135]. Furthermore, most of reported alterations consist in single nucleotide mutations that cause amino acid substitution in the corresponding protein.

            Conclusions

            The present study has the limitation to analyze a modest sample size, but has the advantage to include cancer cases from high incidence (Uganda) and low incidence (Italy) geographic regions. The results obtained so far allow to conclude that single nucleotide mutations and/or deletion of STK11 gene are rare events in penile carcinoma suggesting that STK11 genetic alterations do not have a relevant role in the pathogenesis of penile cancer.

            Abbreviations

            HPV: 

            Human Papillomavirus

            STK11: 

            Serine/threonine kinase 11

            LKB1: 

            Liver kinase B1.

            Declarations

            Acknowledgements

            This work was supported by grants from the Ministero della Salute (Programma Integrato Oncologia RO4/2007) and from the ICSC-World Laboratory (project MCD-2/7).

            Authors’ Affiliations

            (1)
            Molecular Biology and Viral Oncology, National Cancer Institute “Fond. Pascale”, Cappella Cangiani
            (2)
            Department of Pathology, National Cancer Institute “Fond. Pascale”

            References

            1. Curado MP, Edwards B, Shin HR, Ferlay J, Heanue M, Boyle P, Storm H: Cancer Incidence in Five Continents. Lyon: IARC Scientific Publications N° 160; 2007.
            2. Chaux A, Cubilla AL: Advances in the pathology of penile carcinomas. Hum Pathol 2012, 43:771–789.PubMedView Article
            3. Dillner J, Meijer CJ, von Krogh G, Horenblas S: Epidemiology of human papillomavirus infection. Scand J Urol Nephrol Suppl 2000, 205:194–200.PubMedView Article
            4. Daling JR, Madeleine MM, Johnson LG, Schwartz SM, Shera KA, Wurscher MA, Carter JJ, Porter PL, Galloway DA, McDougall JK, Krieger JN: Penile cancer: importance of circumcision, human papillomavirus and smoking in in situ and invasive disease. Int J Cancer 2005, 116:606–616.PubMedView Article
            5. Bleeker MC, Heideman DA, Snijders PJ, Horenblas S, Dillner J, Meijer CJ: History of circumcision, medical conditions, and sexual activity and risk of penile cancer. World J Urol 2009, 27:141–150.PubMedView Article
            6. Maden C, Sherman KJ, Beckmann AM, Hislop TG, Teh CZ, Ashley RL, Daling JR: Penile cancer: epidemiology, pathogenesis and prevention. J Natl Canc Inst 1993, 85:19–24.View Article
            7. Miralles-Guri C, Bruni L, Cubilla AL, Castellsague X, Bosch FX, De SS: Human papillomavirus prevalence and type distribution in penile carcinoma. J Clin Pathol 2009, 62:870–878.PubMedView Article
            8. Cubilla AL, Lloveras B, Alejo M, Clavero O, Chaux A, Kasamatsu E, Velazquez EF, Lezcano C, Monfulleda N, Tous S, Alemany L, Klaustermeier J, Munoz N, Quint W, De SS, Bosch FX: The basaloid cell is the best tissue marker for human papillomavirus in invasive penile squamous cell carcinoma: a study of 202 cases from Paraguay. Am J Surg Pathol 2010, 34:104–114.PubMedView Article
            9. Annunziata C, Buonaguro L, Buonaguro FM, Tornesello ML: Characterization of the human papillomavirus (HPV) integration sites into genital cancers. Molecular and genetic pathways in penile cancer. Pathol Oncol Res 2012, 18:803–808.PubMedView Article
            10. Kayes O, Ahmed HU, Arya M, Minhas S: Molecular and genetic pathways in penile cancer. Lancet Oncol 2007, 8:420–429.PubMedView Article
            11. Hemminki A, Avizienyte E, Roth S, Loukola A, Aaltonen LA, Jarvinen H, Dela CA: A serine/threonine kinase gene defective in Peutz-Jeghers syndrome. Duodecim 1998, 114:667–668.PubMed
            12. Jenne DE, Reimann H, Nezu J, Friedel W, Loff S, Jeschke R, Muller O, Back W, Zimmer M: Peutz-Jeghers syndrome is caused by mutations in a novel serine threonine kinase. Nat Genet 1998, 18:38–43.PubMedView Article
            13. Alessi DR, Sakamoto K, Bayascas JR: LKB1-dependent signaling pathways. Annu Rev Biochem 2006, 75:137–163.PubMedView Article
            14. Marignani PA: LKB1, the multitasking tumour suppressor kinase. J Clin Pathol 2005, 58:15–19.PubMedView Article
            15. Ollila S, Makela TP: The tumor suppressor kinase LKB1: lessons from mouse models. J Mol Cell Biol 2011, 3:330–340.PubMedView Article
            16. Boardman LA, Thibodeau SN, Schaid DJ, Lindor NM, McDonnell SK, Burgart LJ, Ahlquist DA, Podratz KC, Pittelkow M, Hartmann LC: Increased risk for cancer in patients with the Peutz-Jeghers syndrome. Ann Intern Med 1998, 128:896–899.PubMed
            17. Giardiello FM, Welsh SB, Hamilton SR, Offerhaus GJ, Gittelsohn AM, Booker SV, Krush AJ, Yardley JH, Luk GD: Increased risk of cancer in the Peutz-Jeghers syndrome. N Engl J Med 1987, 316:1511–1514.PubMedView Article
            18. Giardiello FM, Brensinger JD, Tersmette AC, Goodman SN, Petersen GM, Booker SV, Cruz-Correa M, Offerhaus JA: Very high risk of cancer in familial Peutz-Jeghers syndrome. Gastroenterology 2000, 119:1447–1453.PubMedView Article
            19. Conde E, Suarez-Gauthier A, Garcia-Garcia E, Lopez-Rios F, Lopez-Encuentra A, Garcia-Lujan R, Morente M, Sanchez-Verde L, Sanchez-Cespedes M: Specific pattern of LKB1 and phospho-acetyl-CoA carboxylase protein immunostaining in human normal tissues and lung carcinomas. Hum Pathol 2007, 38:1351–1360.PubMedView Article
            20. Kuragaki C, Enomoto T, Ueno Y, Sun H, Fujita M, Nakashima R, Ueda Y, Wada H, Murata Y, Toki T, Konishi I, Fujii S: Mutations in the STK11 gene characterize minimal deviation adenocarcinoma of the uterine cervix. Lab Invest 2003, 83:35–45.PubMed
            21. Matsumoto S, Iwakawa R, Takahashi K, Kohno T, Nakanishi Y, Matsuno Y, Suzuki K, Nakamoto M, Shimizu E, Minna JD, Yokota J: Prevalence and specificity of LKB1 genetic alterations in lung cancers. Oncogene 2007, 26:5911–5918.PubMedView Article
            22. Kim CJ, Cho YG, Park JY, Kim TY, Lee JH, Kim HS, Lee JW, Song YH, Nam SW, Lee SH, Yoo NJ, Lee JY, Park WS: Genetic analysis of the LKB1/STK11 gene in hepatocellular carcinomas. Eur J Cancer 2004, 40:136–141.PubMedView Article
            23. Kenanli E, Karaman E, Enver O, Ulutin T, Buyru N: Genetic alterations of the LKB1 gene in head and neck cancer. DNA Cell Biol 2010, 29:735–738.PubMedView Article
            24. McCabe MT, Powell DR, Zhou W, Vertino PM: Homozygous deletion of the STK11/LKB1 locus and the generation of novel fusion transcripts in cervical cancer cells. Canc Genet Cytogenet 2010, 197:130–141.View Article
            25. Wingo SN, Gallardo TD, Akbay EA, Liang MC, Contreras CM, Boren T, Shimamura T, Miller DS, Sharpless NE, Bardeesy N, Kwiatkowski DJ, Schorge JO, Wong KK, Castrillon DH: Somatic LKB1 mutations promote cervical cancer progression. PLoS One 2009, 4:e5137.PubMedView Article
            26. Tornesello ML, Duraturo ML, Losito S, Botti G, Pilotti S, Stefanon B, De PG, Gallo A, Buonaguro L, Buonaguro FM: Human papillomavirus genotypes and HPV16 variants in penile carcinoma. Int J Cancer 2008, 122:132–137.PubMedView Article
            27. Fredricks DN, Relman DA: Paraffin removal from tissue sections for digestion and PCR analysis. Biotechniques 1999, 26:198–200.PubMed
            28. Tornesello ML, Buonaguro FM, Meglio A, Buonaguro L, Beth-Giraldo E, Giraldo G: Sequence variations and viral genomic state of human papillomavirus type 16 in penile carcinomas from Ugandan patients. J Gen Virol 1997,78(Pt 9):2199–2208.PubMed
            29. Gentile G, Giraldo G, Stabile M, Beth-Giraldo E, Lonardo F, Kyalwazi SK, Perone L, Ventruto V: Cytogenetic study of a cell line of human penile cancer. Ann Genet 1987, 30:164–169.PubMed
            30. Andersson P, Kolaric A, Windahl T, Kirrander P, Soderkvist P, Karlsson MG: PIK3CA, HRAS and KRAS gene mutations in human penile cancer. J Urol 2008, 179:2030–2034.PubMedView Article
            31. Levi JE, Rahal P, Sarkis AS, Villa L: Human papillomavirus DNA and p53 status in penile carcinomas. Int J Cancer 1998, 76:779–783.PubMedView Article
            32. Soufir N, Queille S, Liboutet M, Thibaudeau O, Bachelier F, Delestaing G, Balloy BC, Breuer J, Janin A, Dubertret L, Vilmer C, Basset-Seguin N: Inactivation of the CDKN2A and the p53 tumour suppressor genes in external genital carcinomas and their precursors. Br J Dermatol 2007, 156:448–453.PubMedView Article
            33. Poetsch M, Hemmerich M, Kakies C, Kleist B, Wolf E, Vom DF, Hakenberg OW, Protzel C: Alterations in the tumor suppressor gene p16(INK4A) are associated with aggressive behavior of penile carcinomas. Virchows Arch 2011, 458:221–229.PubMedView Article
            34. Rocha RM, Ignacio JA, Jordan J, Carraro DM, Lisboa B, Lopes A, Carvalho KC, Da CI, Cubilla A, Guimaraes GC, Vassallo J, Soares FA: A clinical, pathologic, and molecular study of p53 and murine double minute 2 in penile carcinogenesis and its relation to prognosis. Hum Pathol 2012, 43:481–488.PubMedView Article
            35. Yanagawa N, Osakabe M, Hayashi M, Tamura G, Motoyama T: Detection of HPV-DNA, p53 alterations, and methylation in penile squamous cell carcinoma in Japanese men. Pathol Int 2008, 58:477–482.PubMedView Article

            Copyright

            © Annunziata et al.; licensee BioMed Central Ltd. 2013

            This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

            Advertisement