Skip to main content

Table 1 Primers used in the PCR assay for detecting β-globin, Mollicutes, Helicobacter pylori, Fusobacterium nucleatum, and Mycoplasma hyorhinis

From: Evaluating the presence of Mycoplasma hyorhinis, Fusobacterium nucleatum, and Helicobacter pylori in biopsies of patients with gastric cancer

Primer Sequence (5′–3′) Location Amplicons Ref
PC03 ACACAACTGTGTTCACTAGC nt 1575-1594 110 bp [29]
PC04 CAACTTCATCCACGTTTCAC nt 1684-1669   
GPO3 GGGAGCAAACACGATAGATACCCT nt 221-245 270 bp [32]
MGSO TGCACCATCTGTCACTCTGTTAACCTC nt 491-465   
JW21 GCGACCTGCTGGAACATTAC nt 691-710 138 bp [33]
JW22 CGTTAGCTGCATTACTGGAGA nt 829-809   
FNF CAACACCTAGTAATCATC nt 2.443.126-2.443.126 653 bp  
FNR CGAATGCTAATACCTATA nt 2.443.761-2.443.778   [35]
FN-Probe Cy5-GGCTTCCCCATCGGCATTCC-BHQ nt 2.443.229-2.443.248 604 bp [34]
MHRHF GAACGGGA TGTAGCAATACATTC nt 18520-18542   
MHRHR AGCGGACTGAAGTTGAGCTTCAG nt 19124-19102   
Mhr-p37-RT-F TATCTCATTGACCTTGACTAAC nt 768.070-768.092 89 bp [15]
Mhr-p37-RT-R ATTTTCGCCAATAGCATTTG nt 816.070-835.070   
Mhr-p37-RT-Probe 6FAM-CATCCTCTTGCTTGACTACTCCTG-MGBNFQ nt 774.070-796.070   
  1. Target sequences for β-globin amplification – PC03/PC04 (110 bp). Target sequences for 16S rRNA of Mollicutes—GPO3/MGSO (270 bp), H. pylori—JW21/JW22 (138 bp), F. nucleatum—FNF/FNR (653 bp), M. hyorhinis—MHRHF/MHRHR (604 bp), and for p37 gene rRNA of M. hyorhinis—Mhr-p37-RT-F/ Mhr-p37-RT-R / Mhr-p37-RT-Probe (89 bp)