Skip to main content

Table 2 The primer sequences used for RT-qPCR

From: HPV16 E6 enhances the radiosensitivity in HPV-positive human head and neck squamous cell carcinoma by regulating the miR-27a-3p/SMG1 axis

Gene Primer
HPV16 E6 Forward: CTGCAATGTTTCAGGACCCAC
Reverse: GTTGTTTGCAGCTCTGTGCAT
DGCR8 Forward: GTGCATGCTTGTCCCTTTGG
Reverse: TGCCAACATACCTCGTAGGG
miR-27a-3p Forward: CAGTTCACAGTGGCTAAGTTC
Reverse: CAGTTTTTTTTTTTTTTTGCGGAA
SMG1 Forward: AGTTAATGGAGGCCACACCC
Reverse: ACTCTAAGGCTTTTACCTTTTTCAA
GAPDH Forward: AATCCCATCACCATCTTCC
Reverse: ATCCGTTGACTCCGACCTTCAC
U6 Forward: GAGTCCTTCCACGATACCAA
Reverse: AACGCT TCACGAATT TGC