Skip to main content

Table 1 Sequences of siRNAs against specific targets

From: HPV16 E6 enhances the radiosensitivity in HPV-positive human head and neck squamous cell carcinoma by regulating the miR-27a-3p/SMG1 axis

Gene Sequences
si-DGCR8 guide strand: UCAUUUUCUUAUAAUGCAGAC
passenger strand: CUGCAUUAUAAGAAAAUGAAG
si-E6 guide strand: AAUCGUAAACACACUUUACAU
passenger strand: GUAAAGUGUGUUUACGAUUGC