Skip to main content

Table 1 Primers used for the molecular characterization of fourteen human papillomavirus E6 and E7 genes

From: Phylogeny and polymorphism in the E6 and E7 of human papillomavirus: alpha-9 (HPV16, 31, 33, 52, 58), alpha-5 (HPV51), alpha-6 (HPV53, 66), alpha-7 (HPV18, 39, 59, 68) and alpha-10 (HPV6, 44) in women from Shanghai

HPV genotypeReference sequence IDGeneDirectionSequence 5′-3’Primer positionProduct size, bpAnnealing Temperature, °C
6KU298876.1E6, E7ForwardAGGGACCGAAAACGGTTCAA32107958
ReverseCTAACATATGGACTACCTAAAT1110  
16NC_001526E6ForwardACCGTTTTGGGTTACACATTTAC699670060
ReverseCTGTCATTTAATTGCTCATAACAGTAGA7695  
E7ForwardCATTAGAACAGCAATACAACAAACC740557960
ReverseTCCACTACAGCCTCTACATAAAACC7983  
18NC_001526E6, E7ForwardCATGTCCAACATTCTGTCTACCC7751106458
ReverseTTACAACCCGTGCCCTCC957  
31J04353.1E6, E7ForwardAGTAGGGAGTGACCGAAAGTGG2795958
ReverseCACTACTGTCTTCATTTTCGTCCTC985  
33M12732.1E6, E7ForwardAACTATGCCTTGTAAAAGTGAGTCAC7813111658
ReverseTAAATCCGTGCCACTGTCATC1015  
39M62849.1E6, E7ForwardAAGGGAGTAACCGAAAACGG34109658
ReverseCCTGTGCTGTCTCACGCTCT1129  
44U31788.1E6, E7ForwardATCGGTTGACACACACCCTG7796108358
ReverseCATCCGCCTCCTGTCGTTTAACAA1045  
51KU298901.1E6, E7ForwardACTAGGGTGTAACCGAAAAGGG1796558
ReverseTCATCCTCATCATCCGAAACAT981  
52NC_001592.1E6ForwardACCGTACCCACAACCACTTTT792973858
ReverseTTGTGGCTTGTTCTGCTTGTC706  
E7ForwardAACGCCATTATGTCCTGAAGAA42255458
ReverseCATCCTCGTCCTCTGAAATGTTAT975  
53GQ472849.1E6, E7ForwardAGACAGGGAGTAACCGAAATAGG2498858
ReverseGCTTTCCTCGTCTGTTTCATCTT1011  
58D90400E6ForwardCGTTTTGGGTCACATTGTTCA778270258
ReverseCATAATTGCTCATAGCAGAATAGGTC659  
E7ForwardTTCGCTATATGGAGACACATTAGAA35261358
ReverseTTCTTCGTTCTATTACCGCTTCTA964  
59X77858.1E6, E7ForwardAAGCAACCGAAAAAGGTCGG7805112858
ReverseTGTGGTATCATCAATAAAATCTACC1036  
66U31794.1E6, E7ForwardTTGGGAGTAACCGAAATGGG2799258
ReverseCATTCTCCTCCTCGCTTTCAT1018  
68DQ080079E6, E7ForwardCCGAAAAAGGTTGGGCACAC7682109858
ReverseTGAACCTGTATCTGTTGCGTT958  
  1. HPV Human papillomavirus