Skip to main content

Advertisement

Table 1 Sequences of the oligonucleotides used in the RT-qPCR assays to quantify E6, E7 and glycogenes expression level

From: Glycogene expression profiles based on microarray data from cervical carcinoma HeLa cells with partially silenced E6 and E7 HPV oncogenes

Name Sequence PCR Product
E6 Forward 5’GCGACCCTACAAGCTACCTGAT 3´ 295 bp
E6 Reverse 5’GCACCGCAGGCACCTTAT 3´
E7 Forward 5´ TGTCACGAGCAATTAAGCGACT 3´ 215 bp
E7 Reverse 5´ CACACAAAGGACAGGGTGTTC 3’
POFUT1 Forward 5’CAGCCCAGTTCCCCGTCCTA3´ 190 bp
POFUT1 Reverse 5’GAGCCTGCAGTCCCGTCCTTC3´
UGT8 Forward 5’AAACCAGCCAGCCCACTACCAG3´ 93 bp
UGT8 Reverse 5’GACACCAGCTCCAAAAGACACCAA3´
XXLYLT1 Forward 5’GTGCTGGCTTGGGAACCTACTA3´ 230 bp
XXLYLT1 Reverse 5’GCGGAACTGCCAGAATGTGT3´
DPY19L1 Forward 5’GAGAGTGTACCCGTGTAATGTG3´ 134 bp
DPY19L1 Reverse 5’GAGTGCAATCAAGCTTCCTCTA3´
PIGV Forward 5’ CCTGGGCAACTTGGACATA 3’ 95 bp
PIGV Reverse 5’ GGGCTTCTCTAGGGTCTTATTG 3’
ALG14 Forward 5’ CCGGGAGTCTCTCAGTATCTT 3’ 100 bp
ALG14 Reverse 5’ TCTAGGTGAGTAGGCATTGGA 3’
GALNT1 Forward 5’ GGATAAAGCCACAGAAGAGGATAG 3’ 94 bp
GALNT1 Reverse 5’ CAGGGTGACGTTTCGAAGAA 3’  
HPRT Forward 5’CCTGGCGTCGTGATTAGTGATGAT3´ 136 bp
HPRT Reverse 5’CGAGCAAGACGTTCAGTCCTGTC3´