Skip to main content

Table 1 PCR primers used for standard and semi-nested PCR

From: High risk human papilloma viruses (HPVs) are present in benign prostate tissues before development of HPV associated prostate cancer

Primers Primer sequence (5’➔ 3′) Target
ß-Globin forward GAAGAGCCAAGGACAGGTAC ß-globin
ß-Globin reverse CAACTTCATCCACGTTCACC
 MY11b GCACAGGGYCAYAAYAATGG HPV L1
 Gp6 + c AATCATATTCCTCMMCATGTC
 Gp5+ b TATTTGTTACTGTKGTWGATAC
HPV18 E7 forward GACGAGCCGAACCACAAC HPV18 E7
HPV18 E7 reverse GGATGCACACCACGGACA
HPV16 E7 forward AGCTCA GAGGAGGAGGATGA HPV16 E7
HPV16 E7 reverse GGTTTCTGAGAACAGATGGG
  1. aDegenerate bases: M = A + C, W = A + T, Y = C + T, R = A + G
  2. bForward primer
  3. cReverse primer