Skip to main content

Table 1 Different STS primer sets used for differential identification of Blastocystis subtypes along with expected amplified product sizes

From: Predominance and association risk of Blastocystis hominis subtype I in colorectal cancer: a case control study

STS primer set GenBank accession no. Sequences Product size Subtype
SB83 AF166086 F-GAAGGACTCTCTGACGATGA
R-GTCCAAATGAAAGGCAGC
351 I
SB155 AF166087 F-ATCAGCCTACAATCTCCTC
R-ATCGCCACTTCTCCAAT
650 II
SB227 AF166088 F-ATCAGCCTACAATCTCCTC
R-ATCGCCACTTCTCCAAT
526 III
SB332 AF166091 FGCATCCAGACTACTATCAACATT
R-CCATTTTCAGACAACCACTTA
338 IV
SB340 AY048752 F-TGTTCTTGTGTCTTCTCAGCTC
R-TTCTTTCACACTCCCGTCAT
704 V
SB336 AY048751 F-GTGGGTAGAGGAAGGAAAACA
R-AGAACAAGTCGATGAAGTGAGAT
317 VI
SB337 AY048750 F-GTCTTTCCCTGTCTATTCTGCA
R-AATTCGGTCTGCTTCTTCTG
487 VII