Skip to main content

Advertisement

Table 1 List of primers and annealing temperatures used in this study

From: Prevalence of human papillomavirus in saliva of women with HPV genital lesions

Primer name Sequence (5’ → 3’) Annealing temperature (°C) Fragment lenght (bp)
MY09 CGTCCMARRGGAWACTGATC 58 450
MY11 GCMCAGGGWCATAAYAATGG
HPV6f TAGTGGGCCTATGGCTCGTC 55 280
HPV6r TCCATTAGCCTCCACGGGTG
HPV11f GGAATACATGCGCCATGTGG 58 360
HPV11r CGAGCAGACGTCCGTCCTCG
HPV16f TGCTAGTGCTTATGCAGCAA 55 152
HPV16r ATTTACTGCAACATTGGTAC
HPV18f AAGGATGCTGCACCGGCTGA 58 216
HPV18r CACGCACACGCTTGGCAGGT
HPV31f ATGGTGATGTACACAACACC 55 514
HPV31r GTAGTTGCAGGACAACTGAC
HPV33f ATGATAGATGATGTAACGCC 55 455
HPV33r GCACACTCCATGCGTATCAG
HPV45f ATTTCACAGCATAGCTGGACAGTA 55 100
HPV45r CTATACTTGTGTTTCACTACGTCT
ß-globin f GAAGAGCCAAGGACAGGTAC 57 268
ß-globin r CAACTTCATCCACGTTACC