Molecular diagnosis and phylogenetic analysis of human papillomavirus type-16 from suspected patients in Pakistan

Table 1 In-silico analysis of primers sets using BLAST for detection of high risk human papillomavirus types

Primer sets	Sequence 5-′3′	Degenerate bases	Tm (°C)	Product size (Kb)	Reference	HPV Types
						16	18	31	33	35	39	45	52	56	58	59
HRT1 F	GACAGCGGRTATGGCAATWSTGAAG	3	56	~1460	In this study	+	−	+	+	+	−	−	+	−	+	−
HRT1 R	CCACGTCCTTGAGAAAAAGGATTTCC	0	56	~1460	In this study	+	−	+	+	+	−	−	+	−	+	−
HRT2 F	GAGACACACCWGARTGGATACA	2	56	~1200	In this study	−	+	−	−	−	−	+	−	+	−	−
HRT1 R	CCATAGTTCCTCGCATGTRTCT	1	56	~1200	In this study	−	+	−	−	−	−	+	−	+	−	−
MY09	GCMCAGGGWCATAAYAATGG	3	45	~450	[20]	+	+	+	+	−	+	−	−	−	+	+
MY11	CGTCCMARRGGAWACTGATC	4	45	~450	[20]	+	+	+	+	−	+	−	−	−	+	+
GP5	TTTGTTACTGGTAGATAC	0	40	~140	[21]	−	−	−	−	−	−	−	−	−	−	−
GP6	GAAAAATAAACTGTAAATCA	0	40	~140	[21]	−	−	−	−	−	−	−	−	−	−	−
GP5+	TTTGTTACTGTGGTAGATACTAC	0	40	~145	[22]	+	+	+	−	−	−	+	−	−	−	−
GP6+	GAAAAATAAACTGTAAATCATATTC	0	40	~145	[22]	+	+	+	−	−	−	+	−	−	−	−
CP65	CARGGTCAYAAYAATGGYAT	4	55	~465	[23]	x	x	x	x	x	x	x	x	x	x	x
CP70	AAYTTTCGTCCYARAGRAWATTGRTC	7	55	~465	[23]	x	x	x	x	x	x	x	x	x	x	x
CP66	AATCARMTGTTTRTTACWGT	4	55	~385	[23]	x	x	x	x	x	x	x	x	x	x	x
CP69	GWTAGATCWACATYCCARAA	4	55	~385	[23]	x	x	x	x	x	x	x	x	x	x	x
SPF1	GCICARGGICAYAAYAATGG	5	45	~65	[24]	x	x	x	x	x	x	x	x	x	x	x
SPF2	GTIGTATCIACWACAGTAACAAA	3	45	~65	[24]	x	x	x	x	x	x	x	x	x	x	x

The non-redundant/nucleotide collection (nr) database at National Center of Biotechnology Information (NCBI at http://www.ncbi.nlm.nih.gov/) was searched with the sequence of each primer by nucleotide Blast [27] using default values except maximum target sequences value was selected to 20,000. (+) means that both of the primers in a pair have secured blast hits for a particular HPV types mentioned above, while (−) means that one or both of the primers in a set have not been able to secure any blast hit for a particular HPV types. Due to the presence of many degenerate bases in the primer sequences, the Blast analysis was not been successful for primer sets CP65 & CP70, CP66 & CP69 and SPF1 & SPF2 and is represented by (x). The GP6 primer showed no hit specific to HPV. The product sizes are not exact and may differ slightly depending on the HPV types. The results in the table are based on Blast analysis only and may differ considerably compared to published results or when used empirically, therefore, please refer to the given references for exact details of HPV types amplified by each primer set

ISSN: 1750-9378