Skip to main content

Table 1 List of primers and probes used for the respective genes

From: Impact of Hepatitis C Virus (HCV) infection on biomolecular markers influencing the pathogenesis of bladder cancer

Probe Reverse primer Forward primer Genes
5'FAM-CAGCACTTCTTTTGAGCACACGGTCG-3'TAMRA CAGTGGTTTAGGAGGGTTGCTT TTCCAGAAAATAAATCAGATGGTATGTAA Rb1
5'FAM- TTGCAAAGCATTGGAATCAGACAGCACT- 3'TAMRA CTCGGCCCTCTTTTCTCTG GCACTGGCTGATGAGTGTGT hTERT
  AGCACCGCCGTCTGGTTGGC CGGCAGTGGCGGTGGTGGTG FGFR3
5'FAM-CTGTGACTTGCACGTACTCCCCTGCC- -3'TAMRA AAGACCTGCCCTGTGCAGC CGTCTGGGCTTCTTGCATTC TP53
5'FAM-CGGCAGACCAGCATGACAGATTTCTACCA-3'TAMRA GAGGAAGCCTAATCCGCC CTGGAGACTCTCAGGGTCGAAA CDKN1A (P21)
5'FAM-CAAGCTTCCCGTTCTCAGCC- 3'TAMRA GAAGATGGTGATGGGATTTC GAAGGTGAAGGTCGTAGTC GAPDH