Skip to main content

Table 1 Primer sequences used for PCR, nucleotide sequence analysis and Real-time PCR amplification of STK11 exons 1 to 9

From: Somatic mutations of STK11 gene in human papillomavirus positive and negative penile cancer

Region Forward (5’-3’) Reverse (5’-3’) Product length Annealing temperature (°C)
STK11 exon 1 ACAATCGTTTCTGTTGGAAG TCCTTGTGTTCCGACTTC 113 bp 55
STK11 exon 2 CTCTAGGGAAGGGAGGAG TTTCTGCTTCTCTTCGTTG 201 bp 61
STK11 exon 3 TGAGCTGTGTGTCCTTAG CACTGGGAAACGCTTCTC 102 bp 60
STK11 exon 4 CCCGCAGGTACTTCTGTC GTGGTGAGCAGCAGGTTC 100 bp 61
STK11 exon 5 CCTGAGGGCTGCACGGCACC GGGGCGGGGCACTTACAGG 180 bp 69
STK11 exon 6 TCGAAATGAAGCTACAACATC TTTCAGCAGGTCAGAGAG 138 bp 61
STK11 exon 7 TTCTCCTCAGGGATGCTTG CACCTGTGCTGCCGGATC 71 bp 60
STK11 exon 8 ATGACTGTGGTGCCGTAC CCGTGAAGTCCTGAGTGTAG 100 bp 61
STK11 exon 9 CAGGACAGGTCCCAGAAGAG CCAGCCTCACTGCTGCTT 203 bp 67