Skip to main content

Table 4 Oligonucleotides used

From: Quantitative analysis of human herpesvirus-6 genome in blood and bone marrow samples from Tunisian patients with acute leukemia: a follow-up study

Primers and probes Orientation Sequence (5’ 3’) References
HHV-6 detection
Taq1 + GACAATCACATGCCTGGATAATG [21]
Taq 2 - TGTAAGCGTGTGGTAATGGACTAA
H6S probe FAM-AGCAGCTGGCGAAAAGTGCTGTGC-TAMRA
Human albumin gene
Alb-forward + GCTGTCATCTCTTGTGGGCTGT [22]
Alb-reverse - ACTCATGGGAGCTGCTGGTTC
Alb-probe FAM-CCTGTCATGCCCACACAAATCTCTCC-TAMRA
HHV-6 (A and B)
HHV-6A - TGGTAATGGACTAATTGTGTGTTGTTTTA [23]
HHV-6B - TGGTAATGGACTAAGTGTGCGTTATTTTC