Skip to main content

Table 1 PCR primers used

From: Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

Amplified region Primer Sequences Melting temperature Amplimer length
HPV16 E7 Pr. 591-620 5'ATA TAT GTT AGA TTT GCA ACC AGA GAC AAC 3' 55.9°C 196 bp
  Pr. 786-762 5'GTC TAC GTG TGT GCT TTG TAC GCA C 3' 54.2°C  
HPV18 E7 Pr. 533-553 5'CCG AGC ACG ACA GGA GAG GCT 3' 60.3°C 172 bp
  Pr. 705-682 5' TCG TTT TCT TCC TCT GAG TCG CTT 3' 57.5°C  
β-actin Pr. 6999-7018 5'CCACACTGTGCCCATCTACG3' 53.6°C 99 bp