Skip to main content

Table 3 Primers used for HCMV DNA amplification by real-time quantitative PCR

From: Analysis of colorectal cancers for human cytomegalovirus presence

primer sequence amplicon length gene position
US28 S TCCATCGGCAACTTCTTGGT 65 bp 267671 to 267690
HHV5-US28As TCGCCGGAGCATTGAATC   267718 to 267735
  1. Oligonucleotide primers used for amplification of the HCMV US28 gene in real-time PCR. Primers were designed using Primer Express V2.0 software (Applied Biosystems) on the sequence of US28 gene of the AD169 laboratory strain and controlled by aligning sequence with BLAST.
\