Skip to main content

Table 3 Primers used for HCMV DNA amplification by real-time quantitative PCR

From: Analysis of colorectal cancers for human cytomegalovirus presence

primer sequence amplicon length gene position
US28 S TCCATCGGCAACTTCTTGGT 65 bp 267671 to 267690
HHV5-US28As TCGCCGGAGCATTGAATC   267718 to 267735
  1. Oligonucleotide primers used for amplification of the HCMV US28 gene in real-time PCR. Primers were designed using Primer Express V2.0 software (Applied Biosystems) on the sequence of US28 gene of the AD169 laboratory strain and controlled by aligning sequence with BLAST.
Back to article page

Infectious Agents and Cancer

ISSN: 1750-9378

Contact us

\