Skip to main content

Table 2 Primers used for HCMV DNA amplification by nested PCR

From: Analysis of colorectal cancers for human cytomegalovirus presence

primer sequence amplicon length UL55 gene position
E-1 TCCAACACCCACAGTACCCGT 267 bp 655 to 675
E-2 CGGAAACGATGGTGTAGTTCG   902 to 922
I-1 GTCAAGGATCAGTGGCACAGC 182 bp 685 to 705
I-2 GTAGCTGGCATTGCGATTGGT   847 to 867
  1. Primers used for amplification of the HCMV glycoprotein B (UL55) gene in nested PCR. External primers amplify a 267 bp fragment, while internal primers amplify a 182 bp fragment
\