Skip to main content

Advertisement

Table 1 Primers used

From: Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosí City, Mexico

Pair Primer Sequence (5'→3') Amplicon
1 LCRS (F) AAGGGAGTAACCGAAAACGGT E6-1 (~650 pb)
  E7AS (R) TCATCCTCCTCCTCTGAG  
2 E6F (F) CGTAACCGAAATCGGTTGAAC E6-2 (~626 pb)
  PU-2R16 (R) GAGCTGTCGCTTAATTGCTC